Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid(NM_000061.2)

Product Information

NCBI RefSeq: NM_000061.2

RefSeq ORF Size: 1980

cDNA Description: Full length Clone DNA of Homo sapiens Bruton agammaglobulinemia tyrosine kinase.

Gene Synonym: AGMX1,AT,ATK,BPK,IMD1,PSCTK1,XLA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Bruton Tyrosine Kinase / BTK Kinase Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid HG10578-UTLN pLV-untagged 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10578-CFLN pLV-C-FLAG 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10578-CHLN pLV-C-His 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10578-CMLN pLV-C-Myc 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10578-CYLN pLV-C-HA 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10578-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10578-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10578-NFLN pLV-N-Flag 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10578-NHLN pLV-N-His 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10578-NMLN pLV-N-Myc 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10578-NYLN pLV-N-HA 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10578-ANGLN pLV-N-GFPSpark 2-3 weeks
Human Bruton Tyrosine Kinase / BTK Kinase Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10578-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.