Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid(BC107091)

Product Information

NCBI RefSeq: BC107091

RefSeq ORF Size: 726

cDNA Description: Full length Clone DNA of Homo sapiens B and T lymphocyte associated.

Gene Synonym: BTLA1,CD272

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human BTLA/CD272 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid HG11895-UTLN pLV-untagged 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11895-CFLN pLV-C-FLAG 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11895-CHLN pLV-C-His 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11895-CMLN pLV-C-Myc 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11895-CYLN pLV-C-HA 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11895-ACGLN pLV-C-GFPSpark 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11895-ACRLN pLV-C-OFPSpark 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11895-NFLN pLV-N-Flag 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11895-NHLN pLV-N-His 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11895-NMLN pLV-N-Myc 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11895-NYLN pLV-N-HA 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11895-ANGLN pLV-N-GFPSpark 2-3 weeks
Human BTLA/CD272 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11895-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such, reagents that regulate the binding of BTLA to its ligand or alter BTLA signaling have significant therapeutic promise. BTLA is crucial to understand the mechanism(s) of action of these antibodies before attempting clinical applications. BTLA is not expressed by naive T cells, but it is induced during activation and remains expressed on T helper type 1 (T(H)1) but not T(H)2 cells. BTLA is a third inhibitory receptor on T lymphocytes with similarities to cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed death 1 (PD-1).

Immune Checkpoint
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Fourcade J, et al. (2012) CD8(+) T cells specific for tumor antigens can be rendered dysfunctional by the tumor microenvironment through upregulation of the inhibitory receptors BTLA and PD-1. Cancer Res. 72(4):887-96.
  • Kojima R, et al. (2011) Molecular basis for herpesvirus entry mediator recognition by the human immune inhibitory receptor CD160 and its relationship to the cosignaling molecules BTLA and LIGHT. J Mol Biol. 413(4):762-72.
  • Oki M, et al. (2011) A functional polymorphism in B and T lymphocyte attenuator is associated with susceptibility to rheumatoid arthritis. Clin Dev Immunol. 305656.