Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid(BC067540)

Product Information

NCBI RefSeq: BC067540

RefSeq ORF Size: 1380

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 7 receptor.

Gene Synonym: CD127,CDW127,IL-7R,IL-7R-alpha,IL7RA,ILRA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL7R/IL-7R/CD127 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid HG11851-UTLN pLV-untagged 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11851-CFLN pLV-C-FLAG 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11851-CHLN pLV-C-His 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11851-CMLN pLV-C-Myc 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11851-CYLN pLV-C-HA 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11851-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11851-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11851-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11851-NHLN pLV-SP-N-His 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11851-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL7R/IL-7R/CD127 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11851-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin 7 Receptor alpha (IL-7RA), also known as CD127, is a 75 kDa hematopoietin receptor superfamily member that plays an important role in lymphocyte differentiation, proliferation, and survival. IL-7 receptor alpha (CD127) signaling is essential for T-cell development and regulation of naive and memory T-cell homeostasis. IL-7RA is critically required for the proper development and function of lymphoid cells. Therefore, the IL-7RA is critically required for the proper development and function of lymphoid cells. Studies from both pathogenic and controlled HIV infection indicate that the containment of immune activation and preservation of CD127 expression are critical to the stability of CD4(+) T cells in infection. A better understanding of the factors regulating CD127 expression in HIV disease, particularly on T(CM) cells, might unveil new approaches exploiting the IL-7/IL-7R receptor pathway to restore T cell homeostasis and promote immune reconstitution in HIV infection. Factors relevant to HIV infection that could potentially decrease CD127 expression on human CD8(+) T cells. CD127 down-regulation may be an important contributor to HIV-associated T-cell dysfunction. In addition to IL-7, IL-7RA also associates with TSLPR to form the functional receptor for thymic stromal lymphopoietin (TSLP) which indirectly regulates T cell development by modulating dendritic cell activation. Mutations in the human IL-7RA gene cause a type of severe combined immunodeficiency in which the major deficiencies are in T cell development, whereas B and NK cells are relatively normal in number. Variation in the IL7RA gene was recently found associated with multiple sclerosis (MS). The polymorphisms in the IL7RA gene is involved in MS pathogenesis and suggest that IL7RA variation may primarily affect chronic disease courses. Soluble CD127 (sCD127) appears to play an important role in the immunopathogenesis of several chronic infections, multiple sclerosis, and various cancers.

Reference

  • Vranjkovic A, et al. (2007) IL-7 decreases IL-7 receptor alpha (CD127) expression and induces the shedding of CD127 by human CD8+ T cells. Int Immunol. 19(12): 1329-39.
  • Kiazyk SA, et al. (2008) Loss of CD127 expression links immune activation and CD4(+) T cell loss in HIV infection. Trends Microbiol. 16(12): 567-73.
  • Akkad DA, et al. (2009) Variation in the IL7RA and IL2RA genes in German multiple sclerosis patients. J Autoimmun. 32(2): 110-5.
  • Crawley AM, et al. (2010) Soluble IL-7R alpha (sCD127) inhibits IL-7 activity and is increased in HIV infection. J Immunol. 184(9): 4679-87.