Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid(BC113489)

Product Information

NCBI RefSeq: BC113489

RefSeq ORF Size: 651

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 17.

Gene Synonym: FGF-13,FGF-17,HH20

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF-13 / FGF17 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid HG12342-UTLN pLV-untagged 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12342-CFLN pLV-C-FLAG 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12342-CHLN pLV-C-His 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12342-CMLN pLV-C-Myc 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12342-CYLN pLV-C-HA 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12342-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12342-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12342-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12342-NHLN pLV-SP-N-His 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12342-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGF-13 / FGF17 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12342-NYLN pLV-SP-N-HA 2-3 weeks

Background

FGF-13, also known as FGF17, belongs to the fibroblast growth factor (FGF) family. Members of this family show broad mitogenic and cell survival activities, and play a role in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF-13 is preferentially expressed in the embryonic brain. It interacts with FGFR3 and FGFR4. FGF-13 plays an important role in the regulation of embryonic development and as signaling molecule in the induction and patterning of the embryonic brain. It is also required for normal brain development.

Reference

  • Polnaszek N, et al. (2004) FGF17 is an autocrine prostatic epithelial growth factor and is upregulated in benign prostatic hyperplasia. Prostate. 60(1):18-24.
  • Xu J, et al. (2000) Temporal and spatial gradients of Fgf8 and Fgf17 regulate proliferation and differentiation of midline cerebellar structures. Development. 127(9):1833-43.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.