Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD59 Gene Lentiviral ORF cDNA expression plasmid(NM_000611.5)

Product Information

NCBI RefSeq: NM_000611.5

RefSeq ORF Size: 387

cDNA Description: Full length Clone DNA of Homo sapiens CD59 molecule, complement regulatory protein.

Gene Synonym: 16.3A5,1F5,EJ16,EJ30,EL32,FLJ38134,FLJ92039,G344,HRF-20,HRF20,MAC-IP,MACIF,MEM43,MGC2354,MIC11,MIN1,MIN2,MIN3,MIRL,MSK21,p18-20

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD59 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD59 Gene Lentiviral ORF cDNA expression plasmid HG12474-UTLN pLV-untagged 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12474-CFLN pLV-C-FLAG 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12474-CHLN pLV-C-His 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12474-CMLN pLV-C-Myc 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12474-CYLN pLV-C-HA 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12474-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12474-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12474-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12474-NHLN pLV-SP-N-His 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12474-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD59 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12474-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD59 glycoprotein, also known as 20 kDa homologous restriction factor, HRF20, MAC-inhibitory protein, Membrane attack complex inhibition factor, Membrane inhibitor of reactive lysis, MIC11, MIRL and CD59, is a cell membrane protein which contains one UPAR/Ly6 domain. CD59 is a small, highly glycosylated, GPI-linked protein, with a wide expression profile. The soluble form of CD59 from urine retains its specific complement binding activity, but exhibits greatly reduced ability to inhibit MAC assembly on cell membranes. CD59 is a potent inhibitor of the complement membrane attack complex (MAC) action. CD59 was first identified as a regulator of the terminal pathway of complement. It acts by binding to the C8 and/or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore. This inhibitor appears to be species-specific. CD59 is involved in signal transduction for T-cell activation complexed to a protein tyrosine kinase. Defects in CD59 are the cause of CD59 deficiency (CD59D).

Reference

  • Fletcher CM. et al., 1994, Structure. 2: 185-99.
  • Rudd PM. et al., 1997, J Biol Chem. 272: 7229-44.
  • Kimberley FC. et al., 2007, Mol Immunol. 44 (1-3): 73-81.
  • Gong Y. et al., 2007, Sci China C Life Sci. 50 (6): 773-9.
  • Picariello G. et al., 2008, Proteomics 8: 3833-47.
  • Heibeck TH. et al., 2009, J Proteome Res. 8: 3852-61.