Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid(BC026263)

Product Information

NCBI RefSeq: BC026263

RefSeq ORF Size: 1050

cDNA Description: Full length Clone DNA of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 8.

Gene Synonym: CD66b,CD67,CGM6,NCA-95

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CEACAM8/CD66b/CD67 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid HG13041-UTLN pLV-untagged 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13041-CFLN pLV-C-FLAG 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13041-CHLN pLV-C-His 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13041-CMLN pLV-C-Myc 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13041-CYLN pLV-C-HA 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13041-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13041-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13041-NFLN pLV-SP-N-Flag 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13041-NHLN pLV-SP-N-His 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13041-NMLN pLV-SP-N-Myc 2-3 weeks
Human CEACAM8/CD66b/CD67 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13041-NYLN pLV-SP-N-HA 2-3 weeks

Background

CEACAM8, also known as CD66b or NCA-95, is a single chain, GPI-anchored, highly glycosylated protein belonging to the carcinoembryonic antigen family. There are four members in this family: CD66a, CD66b, CD66c, and CD66d. Members of CEACAM family are widely expressed especially on human neutrophils, and, depending on the tissue, capable of regulating diverse functions including tumor promotion, tumor suppression, angiogenesis, and neutrophil activation. Abnormal overexpression and downregulation of some CEACAMs have been described in tumor cells. Monoclonal antibodies grouped in the CD66 cluster recognize CEACAM members. Ectopic CD66 expression is commonly detected in B-cell lineage acute lymphoblastic leukemia (ALL). CEACAM8(CD66b) is also an activation marker for human granulocytes. However, its biological functions are largely unknown in eosinophils. It has been reported that CD66b is highly expressed on the surface of human peripheral blood eosinophils isolated from healthy individuals. Engagement of CD66b by mAb or a natural ligand, galectin-3, activated a Src kinase family molecule, hemopoietic cell kinase (Hck), and induced cellular adhesion, superoxide production, and degranulation of eosinophils. CD66b molecules were localized in lipid rafts, and disruption of lipid rafts or removal of the GPI anchor inhibited the adhesion and activation of eosinophils. Importantly, CD66b was constitutively and physically associated with a beta2 integrin, CD11b, and cross-linking of CD66b induced a striking clustering of CD11b molecules. Thus, CD66b molecules are involved in regulating adhesion and activation of eosinophils, possibly through their localization in lipid rafts and interaction with other cell surface molecules, such as CD11b. Binding of exogenous or endogenous carbohydrate ligands(s) to CD66b may be important in the release of proinflammatory mediators by human eosinophils.

Reference

  • Yoon J, et al. (2007) CD66b regulates adhesion and activation of human eosinophils. J Immunol. 179 (12): 8454-62.
  • Skubitz KM, et al. (1996) CD6a, CD66b, CD66c, and CD66d each independently stimulate neutrophils. J Leukoc Biol. 60 (1): 106-17.
  • Skubitz KM, et al. (2008) Inte rdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells. J Transl Med. 6: 78.
  • Lasa A, et al. (2008) High expression of CEACAM6 and CEACAM8 mRNA in acute lymphoblastic leukemias. Ann Hematol. 87 (3): 205-11.