Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human C8G Gene Lentiviral ORF cDNA expression plasmid(NM_000606.2.)

Product Information

NCBI RefSeq: NM_000606.2.

RefSeq ORF Size: 609

cDNA Description: Full length Clone DNA of Homo sapiens complement component 8, gamma polypeptide.

Gene Synonym: C8C

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human C8G Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human C8G Gene Lentiviral ORF cDNA expression plasmid HG13304-UTLN pLV-untagged 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13304-CFLN pLV-C-FLAG 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13304-CHLN pLV-C-His 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13304-CMLN pLV-C-Myc 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13304-CYLN pLV-C-HA 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13304-ACGLN pLV-C-GFPSpark 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13304-ACRLN pLV-C-OFPSpark 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13304-NFLN pLV-SP-N-Flag 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13304-NHLN pLV-SP-N-His 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13304-NMLN pLV-SP-N-Myc 2-3 weeks
Human C8G Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13304-NYLN pLV-SP-N-HA 2-3 weeks