Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid(BC106755)

Product Information

NCBI RefSeq: BC106755

RefSeq ORF Size: 1113

cDNA Description: Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase I.

Gene Synonym: CAMKI

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CAMKI/CAMK1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid HG11932-UTLN pLV-untagged 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11932-CFLN pLV-C-FLAG 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11932-CHLN pLV-C-His 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11932-CMLN pLV-C-Myc 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11932-CYLN pLV-C-HA 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11932-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11932-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11932-NFLN pLV-N-Flag 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11932-NHLN pLV-N-His 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11932-NMLN pLV-N-Myc 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11932-NYLN pLV-N-HA 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11932-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CAMKI/CAMK1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11932-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Calcium/calmodulin-dependent protein kinase or CaM kinases are serine/threonine-specific protein kinases that are primarily regulated by the Calcium/calmodulin complex. These kinases show a memory effect on activation. CaM kinases activity can outlast the intracellular calcium transient that is needed to activate it. In neurons, this property is important for the induction of synaptic plasticity. Pharmacological inhibition of CaM kinases II blocks the induction of long-term potentiation. Upon activation, CaM kinases II phosphorylates postsynaptic glutamate receptors and changes the electrical properties of the synapse.

Calcium/calmodulin-dependent protein kinase type 1D, also known as CaM kinase I delta, CaM kinase ID, CaMKI-like protein kinase, CKLiK and CAMK1D, is a member of the protein kinase superfamily and CaMK subfamily. It contains one protein kinase domain. CAMK1D is broadly expressed. It is highly and mostly expressed in polymorphonuclear leukocytes (neutrophilic and eosinophilic granulocytes) while little or no expression is observed in monocytes and lymphocytes. Engineered overexpression of CAMK1D in non-tumorigenic breast epithelial cells led to increased cell proliferation, and molecular and phenotypic alterations indicative of epithelial-mesenchymal transition (EMT), including loss of cell-cell adhesions and increased cell migration and invasion. CAMK1D is a potential therapeutic target with particular relevance to clinically unfavorable basal-like tumors.

Reference

  • Lisman, JE. et al., 1985, Proc Natl Acad Sci USA. 82 (9): 3055-7.
  • Bergamaschi, A. et al., 2008, Mol Oncol. 2 (4): 327-39.
  • White RB. et al., 2008, Physiological genomics, 33 (1): 41-9.
  • Schleinitz, D. et al., 2010, Horm Metab Res. 42 (1): 14-22.