Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid(NM_198196.2)

Product Information

NCBI RefSeq: NM_198196.2

RefSeq ORF Size: 1758

cDNA Description: Full length Clone DNA of Homo sapiens CD96 molecule

Gene Synonym: TACTILE

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD96/TACTILE Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid HG29657-UTLN pLV-untagged 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG29657-CFLN pLV-C-FLAG 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG29657-CHLN pLV-C-His 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG29657-CMLN pLV-C-Myc 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG29657-CYLN pLV-C-HA 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG29657-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG29657-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG29657-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG29657-NHLN pLV-SP-N-His 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG29657-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD96/TACTILE Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG29657-NYLN pLV-SP-N-HA 2-3 weeks

Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD155 ligand CD96 is a member of the Ig superfamily. It's a immunoglobulin-like protein tentatively allocated to the repertoire of human NK receptors. NK cells recognize poliovirus receptor (PVR), a nectins and nectin-like protein family member serve to mediate cell-cell adhesion, cell migration, with the presence of an additional receptor, CD96. CD96 promotes NK cell adhesion to target cells expressing PVR, stimulates cytotoxicity of activated NK cells, and mediates acquisition of PVR from target cells. The effect the cells with mutated CD96 protein lost adhesion and growth activities indicates that CD96 mutations may cause a form of the C syndrome by interfering with cell adhesion and growth.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Anja Fuchs, et al. (2004) Cutting Edge: CD96 (Tactile) Promotes NK Cell-Target Cell Adhesion by Interacting with the Poliovirus Receptor (CD155). The Journal of Immunology.172 (7): 3994-8.
  • Seth S, et al.(2007) The murine pan T cell marker CD96 is an adhesion receptor for CD155 and nectin-1. Biochemical and Biophysical Research Communications. 364 (4): 959-65.