Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid(NM_001735.2)

Product Information

NCBI RefSeq: NM_001735.2

RefSeq ORF Size: 5031

cDNA Description: Full length Clone DNA of Homo sapiens complement component 5.

Gene Synonym: C5a,C5b,C5D,C5Da,Complement 5a,CPAMD4,ECLZB

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human C5a/Complement 5a Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid HG13416-UTLN pLV-untagged 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13416-CFLN pLV-C-FLAG 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13416-CHLN pLV-C-His 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13416-CMLN pLV-C-Myc 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13416-CYLN pLV-C-HA 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13416-ACGLN pLV-C-GFPSpark 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13416-ACRLN pLV-C-OFPSpark 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13416-NFLN pLV-SP-N-Flag 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13416-NHLN pLV-SP-N-His 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13416-NMLN pLV-SP-N-Myc 2-3 weeks
Human C5a/Complement 5a Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13416-NYLN pLV-SP-N-HA 2-3 weeks

Background

C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in humans is generated by the cleavage of C5a convertase on the C5 α-chain during the classical, alternative, and lectin pathways of complement activation. The structure of C5a includes a core region consisting of four, anti-parallel alpha-helices held together by three disulfide linkages and a structured C-terminal tail, and C5a is rapidly metabolised by carboxypeptidase B to a 73 amino acid low activity form, C5a des-Arg. C5a is an extremely potent proinflammatory mediator, as well as a potent chemotactic factor for neutrophils and other leukocytes. It causes histamine release, increases in vascular permeability, induces several cytokines production from leukocytes, enhances neutrophil-endothelial cell adhesion, and augments the humoral and cell-mediated immune response. C5a is quickly metabolised by carboxypeptidases, forming the less potent C5adesArg. Acting via a classical G protein-coupled receptor, CD88, C5a and C5adesArg exert a number of effects essential to the innate immune response, while their actions at the more recently discovered non-G protein-coupled receptor, C5L2 (or GPR77), remain unclear. The widespread expression of C5a receptors throughout the body allows C5a to elicit a broad range of effects. Thus, C5a has been found to be a significant pathogenic driver in a number of immuno-inflammatory diseases, making C5a inhibition an attractive therapeutic strategy. C5a is a strong chemoattractant and is involved in the recruitment of inflammatory cells such as neutrophils, eosinophils, monocytes, and T lymphocytes, in activation of phagocytic cells and release of granule-based enzymes and generation of oxidants, all of which may contribute to innate immune functions or tissue damage. Accordingly, the anaphylatoxin C5a is implicated in a variety of diseases such as rheumatoid arthritis, systemic lupus erythematosus, reperfusion injury, Alzheimer's disease, and sepsis.

Reference

  • Guo RF, et al.. (2005) Role of C5a in inflammatory responses. Annu Rev Immunol. 23: 821-52.
  • Guo RF, et al. (2006) C5a, a therapeutic target in sepsis. Recent Pat Antiinfect Drug Discov. 1(1): 57-65.
  • Manthey HD, et al. (2009) Complement component 5a (C5a). Int J Biochem Cell Biol. 41(11): 2114-7.