Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid(BC069541)

Product Information

NCBI RefSeq: BC069541

RefSeq ORF Size: 729

cDNA Description: Full length Clone DNA of Homo sapiens caspase 14, apoptosis-related cysteine peptidase.

Gene Synonym: CASP14

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Caspase-14/CASP14 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid HG11856-UTLN pLV-untagged 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11856-CFLN pLV-C-FLAG 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11856-CHLN pLV-C-His 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11856-CMLN pLV-C-Myc 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11856-CYLN pLV-C-HA 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11856-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11856-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11856-NFLN pLV-N-Flag 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11856-NHLN pLV-N-His 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11856-NMLN pLV-N-Myc 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11856-NYLN pLV-N-HA 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11856-ANGLN pLV-N-GFPSpark 2-3 weeks
Human Caspase-14/CASP14 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11856-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Caspase 14 is a member of the caspase family. Caspases are a kind of cysteine proteinase consisting of a prodomain plus large and small catalytic subunits, that play a central role in cell apoptosis. Caspase 14 possesses an unusually short prodomain and is highly expressed in embryonic tissues but absent from most of the adult tissues except for the skin, which suggests a role in ontogenesis and skin physiology. Unlike the other short prodomain caspases(caspase-3, caspase-6, and caspase-7), Caspase 14 was not processed by multiple death stimuli including activation of members of the tumor necrosis factor receptor family and expression of proapaptotic members of the bcl-2 family. Caspase 14 has been described to be processed and activated by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may take part in keratinocyte terminal differentiation, which is essential for the skin barrier.

Reference

  • Hu SM, et al. (1998) Caspase-14 is a novel developmentally regulated protease. The journal of biological chemistry. 273: 29648-53.
  • Marc Van De Craen, et al. (1998) Identification of a new caspase homologue: caspase-14. Cell death differ. 5(10): 838-46.