Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid(NM_001227.3)

Product Information

NCBI RefSeq: NM_001227.3

RefSeq ORF Size: 912

cDNA Description: Full length Clone DNA of Homo sapiens caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha.

Gene Synonym: CASP-7,CMH-1,ICE-LAP3,LICE2,MCH3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Caspase-7/MCH3 transcript variant alpha Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid HG10049-UTLN pLV-untagged 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10049-CFLN pLV-C-FLAG 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10049-CHLN pLV-C-His 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10049-CMLN pLV-C-Myc 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10049-CYLN pLV-C-HA 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10049-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10049-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10049-NFLN pLV-N-Flag 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10049-NHLN pLV-N-His 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10049-NMLN pLV-N-Myc 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10049-NYLN pLV-N-HA 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10049-ANGLN pLV-N-GFPSpark 2-3 weeks
Human Caspase-7/MCH3 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10049-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play a role in the signal transduction pathways of apoptosis, necrosis and inflammation. There are two major classes of caspases: initiators and effectors. The initiator isoforms (caspases-1,-4,-5,-8,-9,-10,-11,-12) are activated by, and interact with, upstream adaptor molecules through protein-protein interaction domains known as CARD and DED. Effector caspases (-3,-6,-7) are responsible for cleaving downstream substrates and are sometimes referred to as the executioner caspases. Caspase 7 exists in lung, skeletal muscle, liver, kidney, spleen and heart, and moderately in testis. Caspase 7 cannot be detected in the brain. Caspase 7 functions in the activation cascade of caspases responsible for apoptosis execution. It cleaves and activates sterol regulatory element binding proteins (SREBPs). It proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp- -Gly-217' bond. Overexpression promotes programmed cell death.

Reference

  • Riedl S J, et al. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell. 104(5):791-800.
  • Roy N, et al. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16(23):6914-25.
  • Deveraux Q L, et al. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388(6639): 300-4.