Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid(NM_001042724.1)

Product Information

NCBI RefSeq: NM_001042724.1

RefSeq ORF Size: 1617

cDNA Description: Full length Clone DNA of Homo sapiens poliovirus receptor-related 2 (herpesvirus entry mediator B), transcript variant delta.

Gene Synonym: CD112,HVEB,Nectin-2,PRR2,PVRR2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid HG10005-UTLN pLV-untagged 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10005-CFLN pLV-C-FLAG 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10005-CHLN pLV-C-His 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10005-CMLN pLV-C-Myc 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10005-CYLN pLV-C-HA 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10005-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10005-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10005-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10005-NHLN pLV-SP-N-His 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10005-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD112/Nectin-2/PVRL2 transcript variant alpha Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10005-NYLN pLV-SP-N-HA 2-3 weeks

Background

Cluster of Differentiation 112 (CD112), also known as poliovirus receptor related protein 2 (PVRL2 or PRR2), is a single-pass type I transmembrane glycoprotein belonging to the Immunoglobulin superfamily. CD112 protein also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and thus is involved in cell to cell spreading of these viruses. CD112 protein has been identified as the ligand for DNAM-1 (CD226), and the interaction of CD226/CD112 protein can induce NK cell- and CD8+ T cell-mediated cytotoxicity and cytokine secretion. CD112 has been regarded as a critical component in allergic reactions, and accordingly may function as a novel target for anti-allergic therapy.

Reference

  • Bachelet I, et al. (2006) Mast cell costimulation by CD226/CD112 (DNAM-1/Nectin-2): a novel interface in the allergic process. J Biol Chem. 281(37): 27190-6.
  • Wang L, et al. (2009) Molecular cloning, characterization and three-dimensional modeling of porcine nectin-2/CD112. Vet Immunol Immunopathol. 132(2-4): 257-63.