Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_001024628.2)

Product Information

NCBI RefSeq: NM_001024628.2

RefSeq ORF Size: 1935

cDNA Description: Full length Clone DNA of Homo sapiens neuropilin 1, transcript variant 2.

Gene Synonym: BDCA4,CD304,Neuropilin-1,NP1,NRP,VEGF165R

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10011-UTLN pLV-untagged 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10011-CFLN pLV-C-FLAG 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10011-CHLN pLV-C-His 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10011-CMLN pLV-C-Myc 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10011-CYLN pLV-C-HA 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10011-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10011-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10011-NFLN pLV-SP-N-Flag 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10011-NHLN pLV-SP-N-His 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10011-NMLN pLV-SP-N-Myc 2-3 weeks
Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10011-NYLN pLV-SP-N-HA 2-3 weeks

Background

Neuropilin is a type I transmembrane protein and the molecular mass is 120 kDa. Two homologues, Neuropilin-1 and Neuropilin-2, are identified. The primary structure of Neuropilin-1 and Neuropilin-2 is well conserved and is divided into four domains, CUB (a1/a2) domain, FV/FVIII (b1/b2) domain, MAM (c) domain, and (d) domain that contains a transmembrane and a short cytoplasmic region. Neuropilin-1 (NRP1) acts as a receptor for two different extracellular ligands, class 3 semaphorins and specific isoforms of vascular endothelial growth factor. The functions of NRP1 and NRP2 have been extensively studied in neurons where they act in axon guidance and in endothelial cells where they promote angiogenesis and cell migration. Neuropilin-1 is likely to mediate contacts between the dendritic cells and the T lymphocytes via homotypic interactions and is essential for the initiation of the primary immune response. NRP1 is a co-receptor for VEGF receptor-2 (VEGFR2) that enhances the binding of VEGF165 to VEGFR2 and VEGF165-mediated chemotaxis. NRP1 expression is regulated in EC by tumor necrosis factor-alpha, the transcription factors dHAND and Ets-1, and vascular injury. NRP1 upregulation is positively correlated with the progression of various tumors. Overexpression of NRPI in rat tumor cells results in enlarged tumors and substantially enhanced tumor angiogenesis. On the other hand, soluble NRP1 (sNRP1) is an antagonist of tumor angiogenesis.

Reference

  • Nakamura F, et al. (2002) Structural and functional relation of neuropilins. Adv Exp Med Biol. 515: 55-69.
  • Romeo PH, et al. (2002) Neuropilin-1 in the immune system. Adv Exp Med Biol. 515: 49-54.
  • Klagsbrun M, et al. (2002) The role of neuropilin in vascular and tumor biology. Adv Exp Med Biol. 515: 33-48.
  • Staton CA, et al. (2007) Neuropilins in physiological and pathological angiogenesis. J Pathol. 212(3): 237-48.
  • Bagri A, et al. (2009) Neuropilins in tumor biology. Clin Cancer Res. 15(6): 1860-4.