Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_001773.2)

Product Information

NCBI RefSeq: NM_001773.2

RefSeq ORF Size: 987

cDNA Description: Full length Clone DNA of Homo sapiens CD34 molecule, transcript variant 2.

Gene Synonym: CD34

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD34 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10097-UTLN pLV-untagged 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10097-CFLN pLV-C-FLAG 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10097-CHLN pLV-C-His 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10097-CMLN pLV-C-Myc 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10097-CYLN pLV-C-HA 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10097-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10097-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10097-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10097-NHLN pLV-SP-N-His 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10097-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD34 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10097-NYLN pLV-SP-N-HA 2-3 weeks

Background

Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.

Reference

  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.