Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_001135768.1)

Product Information

NCBI RefSeq: NM_001135768.1

RefSeq ORF Size: 1119

cDNA Description: Full length Clone DNA of Homo sapiens poliovirus receptor (PVR),transcript variant 2.

Gene Synonym: CD155,HVED,Necl-5,NECL5,PVS,TAGE4

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD155/PVR transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10110-UTLN pLV-untagged 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10110-CFLN pLV-C-FLAG 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10110-CHLN pLV-C-His 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10110-CMLN pLV-C-Myc 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10110-CYLN pLV-C-HA 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10110-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10110-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10110-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10110-NHLN pLV-SP-N-His 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10110-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD155/PVR transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10110-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs to the nectins and nectin-like (Necl) subfamily. CD155 was originally identified based on its ability to mediate the cell attachment and entry of poliovirus (PV), an etiologic agent of the central nervous system disease poliomyelitis. The normal cellular function is in the establishment of intercellular adherens junctions between epithelial cells. CD155 may assist in an efficient humoral immune response generated within the intestinal immune system. It has been demonstrated that CD155 can be recognized and bond by DNAM-1 and CD96 which promote the adhension, migration and NK-cell killing, and thus efficiently prime cell-mediated tumor-specific immunity.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Freistadt MS, et al. (2000) Hematopoietic cells from CD155-transgenic mice express CD155 and support poliovirus replication ex vivo. Microb Pathog. 29(4): 203-12.
  • Sato T, et al. (2004) Involvement of heterophilic trans-interaction of Necl-5/Tage4/PVR/CD155 with nectin-3 in formation of nectin- and cadherin-based adherens junctions. Genes Cells. 9(9): 791-9.
  • Kakunaga S, et al. (2004) Enhancement of serum- and platelet-derived growth factor-induced cell proliferation by Necl-5/Tage4/poliovirus receptor/CD155 through the Ras-Raf-MEK-ERK signaling. J Biol Chem. 279(35): 36419-25.
  • Sato T, et al. (2005) Common signaling pathway is used by the trans-interaction of Necl-5/Tage4/PVR/CD155 and nectin, and of nectin and nectin during the formation of cell-cell adhesion. Cancer Sci. 96(9): 578-89.
  • Minami Y, et al. (2007) Involvement of up-regulated Necl-5/Tage4/PVR/CD155 in the loss of contact inhibition in transformed NIH3T3 cells. Biochem Biophys Res Commun. 352(4): 856-60.