Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid(NM_000063.3)

Product Information

NCBI RefSeq: NM_000063.3

RefSeq ORF Size: 2259

cDNA Description: Full length Clone DNA of Homo sapiens complement component 2.

Gene Synonym: ARMD14,CO2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Complement Component C2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid HG10154-UTLN pLV-untagged 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10154-CFLN pLV-C-FLAG 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10154-CHLN pLV-C-His 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10154-CMLN pLV-C-Myc 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10154-CYLN pLV-C-HA 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10154-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10154-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10154-NFLN pLV-SP-N-Flag 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10154-NHLN pLV-SP-N-His 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10154-NMLN pLV-SP-N-Myc 2-3 weeks
Human Complement Component C2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10154-NYLN pLV-SP-N-HA 2-3 weeks

Background

Complement component C2 is part of the classical complement pathway which plays a major role in innate immunity against infection. C2 is a glycoprotein synthesized in liver hepatocytes and several other cell types in extrahepatic tissues. This pathway is triggered by a multimolecular complex C1, and subsequently the single-chain form of C2 is cleaved into two chains referred to C2a and C2b by activated C1. The second component of complement (C2) is a multi-domain serine protease that provides catalytic activity for the C3 and C5 convertases of the classical and lectin pathways of human complement. C4b and C2 was investigated by surface plasmon resonance. C2a containing a serine protease domain combines with complement component C4b to form the C3 convertase C4b2a which is responsible for C3 activation, and leads to the stimulation of adaptive immune responses via Lectin pathway. C2 bound to C4b is cleaved by classical (C1s) or lectin (MASP2) proteases to produce C4bC2a. C2 has the same serine protease domain as C4bC2a but in an inactive zymogen-like conformation, requiring cofactor-induced conformational change for activity. Deficiency of C2 (C2D) is the most common genetic deficiency of the complement system, and two types of C2D have been recognized in the context of specific MHC haplotypes. C2D in human is reported to increase susceptibility to infection, and is associated with certain autoimmune diseases, such as rheumatological disorders.

Reference

  • Laich A, et al. (2002) Complement C4bC2 complex formation: an investigation by surface plasmon resonance. Biochim Biophys Acta. 1544(1-2): 96-112.
  • Halili MA, et al. (2009) Complement component C2, inhibiting a latent serine protease in the classical pathway of complement activation. Biochemistry. 48(35): 8466-72.
  • Krishnan V, et al. (2009) The structure of C2b, a fragment of complement component C2 produced during C3 convertase formation. Acta Crystallogr D Biol Crystallogr. 65(Pt 3): 266-74.