Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid(NM_001734.3)

Product Information

NCBI RefSeq: NM_001734.3

RefSeq ORF Size: 2067

cDNA Description: Full length Clone DNA of Homo sapiens complement component 1, s subcomponent, transcript variant 1.

Gene Synonym: C1s,FLJ44757

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Complement C1s Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid HG10220-UTLN pLV-untagged 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10220-CFLN pLV-C-FLAG 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10220-CHLN pLV-C-His 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10220-CMLN pLV-C-Myc 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10220-CYLN pLV-C-HA 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10220-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10220-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10220-NFLN pLV-SP-N-Flag 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10220-NHLN pLV-SP-N-His 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10220-NMLN pLV-SP-N-Myc 2-3 weeks
Human Complement C1s Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10220-NYLN pLV-SP-N-HA 2-3 weeks

Background

Complement is an integral component of the adaptive and innate immune systems and represents one of the major effector systems for the immune responses. The classical complement pathway is triggered by C1, a complex composed of the binding protein C1q and two proenzymes, C1r and C1s. Upon binding of IgG to the head of C1q, C1r undergoes autoactivation and in turn cleaves and activates C1s. C1r and C1s, the proteases responsible for activation and proteolytic activity of the C1 complex of complement, share similar overall structural organizations featuring five nonenzymic protein modules (two CUB modules surrounding a single EGF module, and a pair of CCP modules) followed by a serine protease domain. Besides highly specific proteolytic activities, both proteases exhibit interaction properties associated with their N-terminal regions. In contrast, C1r and C1s widely differ from each other by their glycosylation patterns: both proteins contain Asn-linked carbohydrates, but four glycosylation sites are present on C1r, and only two on C1s. As a highly specific serine protease, C1s executes the catalytic function of the C1 complex: the cleavage of C4 and C2, and thus instigates a sequence of activation steps of other components of the complement system, culminating in the formation of the membrane attack complex which induces cell lysis. Like other complement serine proteases C1s has restricted substrate specificity and it is engaged into specific interactions with other subcomponents of the complement system. The only other protein known to interact with C1s physiologically is SerpinC1, an inhibitor of serine protease, which inhibits C1s activity and thus plays a regulatory role in controlling the function of C1s enzyme.

Reference

  • Arlaud GJ, et al. (1989) Structure and function of C1r and C1s: current concepts. Behring Inst Mitt. (84): 56-64.
  • Thielens NM, et al. (1999) Structure and functions of the interaction domains of C1r and C1s: keystones of the architecture of the C1 complex. Immunopharmacology. 42(1-3): 3-13.
  • Gl P, et al. (2002) C1s, the protease messenger of C1. Structure, function and physiological significance. Immunobiology. 205(4-5): 383-94.