Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_005581.3)

Product Information

NCBI RefSeq: NM_005581.3

RefSeq ORF Size: 1887

cDNA Description: Full length Clone DNA of Homo sapiens basal cell adhesion molecule (Lutheran blood group), transcript variant 1.

Gene Synonym: AU,CD239,LU,MSK19

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human BCAM / CD239 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10238-UTLN pLV-untagged 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10238-CFLN pLV-C-FLAG 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10238-CHLN pLV-C-His 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10238-CMLN pLV-C-Myc 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10238-CYLN pLV-C-HA 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10238-ACGLN pLV-C-GFPSpark 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10238-ACRLN pLV-C-OFPSpark 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10238-NFLN pLV-SP-N-Flag 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10238-NHLN pLV-SP-N-His 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10238-NMLN pLV-SP-N-Myc 2-3 weeks
Human BCAM / CD239 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10238-NYLN pLV-SP-N-HA 2-3 weeks

Background

The Lutheran (Lu) blood group and basal cell adhesion molecule (BCAM) antigens are both carried by 2 glycoprotein isoforms of the immunoglobulin superfamily representing receptors for the laminin alpha(5) chain. It is a transmembrane receptor with five immunoglobulin-like domains in its extracellular region, and is therefore classified as a member of the immunoglobulin (Ig) gene family. In addition to red blood cells, Lu/BCAM proteins are expressed in endothelial cells of vascular capillaries and in epithelial cells of several tissues. BCAM/LU has a wide tissue distribution with a predominant expression in the basal layer of the epithelium and the endothelium of blood vessel walls. As designated as CD239 recently, BCAM and LU share a significant sequence similarity with the CD146 (MUC18) and CD166, and themselves are adhesion molecules that bind laminin with high affinity. Laminins are found in all basement membranes and are involved in cell differentiation, adhesion, migration, and proliferation. BCAM is upregulated following malignant transformation of some cell types in vivo and in vitro, thus being a candidate molecule involved in tumor progression. In addition, BCAM interacts with integrin in sickle red cells, and thus may potentially play a role in vaso-occlusive episodes.

Reference

  • Kikkawa Y, et al. (2005) Review: Lutheran/B-CAM: a laminin receptor on red blood cells and in various tissues. Connect Tissue Res. 46 (4-5): 193-9.
  • El Nemer W, et al. (2007) Endothelial Lu/BCAM glycoproteins are novel ligands for red blood cell alpha4beta1 integrin: role in adhesion of sickle red blood cells to endothelial cells. Blood. 109 (8): 3544-51.
  • Colin Y, et al. (2008) Red cell and endothelial Lu/BCAM beyond sickle cell disease. Transfus Clin Biol. 15 (6): 402-5.
  • El Nemer W, et al. (2008) Role of Lu/BCAM in abnormal adhesion of sickle red blood cells to vascular endothelium. Transfus Clin Biol. 15 (1-2): 29-33.