Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid(NM_001127593.1)

Product Information

NCBI RefSeq: NM_001127593.1

RefSeq ORF Size: 765

cDNA Description: Full length Clone DNA of Homo sapiens Fc fragment of IgG, low affinity IIIa, receptor (CD16a) transcript variant 3 DNA.

Gene Synonym: CD16,CD16A,Fc gamma RIIIa,FCG3,FCGR3,FCGRIII,FCR-10,FCRIII,FCRIIIA,IGFR3,IMD20

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid HG10389-UTLN pLV-untagged 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10389-CFLN pLV-C-FLAG 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10389-CHLN pLV-C-His 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10389-CMLN pLV-C-Myc 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10389-CYLN pLV-C-HA 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10389-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10389-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10389-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10389-NHLN pLV-SP-N-His 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10389-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD16a/Fc gamma RIIIa transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10389-NYLN pLV-SP-N-HA 2-3 weeks

Background

The Fc receptor with low affinity for IgG (FCGR3, or CD16) is encoded by 2 nearly identical genes, FCGR3A and FCGR3B, resulting in tissue-specific expression of alternative membrane-anchored isoforms. FCGR3A, it is also known as CD16a, encodes a transmembrane protein expressed on activated monocytes/macrophages, natural killer (NK) cells, and a subset of T cells.

CD16a / FCGR3A is a receptor expressed on NK cells that facilitates antibody dependent cellular cytotoxicity (ADCC) by binding to the Fc portion of various antibodies. CD16a / FCGR3A also has a broader function. CD16a / FCGR3A is directly involved in the lysis of some virus-infected cells and tumor cells by NK cells, independent of antibody binding. Cross-linking of CD16a / FCGR3A on NK cells resulted in increased intracellular Ca2+ levels and a cascade of biochemical events similar to those activated by the T cell receptor. CD16a / FCGR3A on human NK cells is a lysis receptor that mediates the direct killing of some virus infected and tumor cells, independent of antibody ligation.

Reference

    1. David Dornan, et al. Effect of FCGR2A and FCGR3A variants on CLL outcome. Blood. 2010 116: 4212-4222
    2. Edberg JC, et al. (2002) Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
    3. Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
    4. Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.