Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid(NM_000242.2)

Product Information

NCBI RefSeq: NM_000242.2

RefSeq ORF Size: 747

cDNA Description: Full length Clone DNA of Homo sapiens mannose-binding lectin (protein C) 2, soluble (opsonic defect).

Gene Synonym: COLEC1,HSMBPC,MBL,MBL2D,MBP,MBP-C,MBP1,MBPD

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MBL/MBL-2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid HG10405-UTLN pLV-untagged 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10405-CFLN pLV-C-FLAG 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10405-CHLN pLV-C-His 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10405-CMLN pLV-C-Myc 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10405-CYLN pLV-C-HA 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10405-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10405-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10405-NFLN pLV-SP-N-Flag 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10405-NHLN pLV-SP-N-His 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10405-NMLN pLV-SP-N-Myc 2-3 weeks
Human MBL/MBL-2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10405-NYLN pLV-SP-N-HA 2-3 weeks

Background

MBL (mannose-binding lectin) is primarily a liver-derived collagen-like serum protein, which binds sugar structures on micro-organisms and on dying host cells and is one of the four known mediators that initiate activation of the complement system via the lectin pathway. MBL and the ficolins (Ficolin-1, Ficolin-2 and Ficolin-3) are soluble collagen-like proteins that are involved in innate immune defence. They bind sugar structures or acetylated compounds present on microorganisms and on dying host cells and they initiate activation of the lectin complement pathway in varying degrees. MBL2 encodes the mannose-binding lectin, which is a key player in the innate immune system and has recently been found to play a role in development of type 1 diabetes and gestational diabetes mellitus. Common variant alleles situated both in promoter and structural regions of the MBL2 gene influence the stability and the serum concentration of the protein. Several polymorphisms in the promoter and structural regions of MBL2 adversely affect the plasma concentration and oligomeric state of MBL. The possession of mutant alleles has been linked to disease outcome for a variety of bacterial and viral infections. Mutant MBL2 haplotypes have been linked to disease progression and response to therapy in HCV infection.

Reference

  • Garred P, et al. (2006) Mannose-binding lectin and its genetic variants. Genes Immun. 7(2): 85-94.
  • Brown KS, et al. (2007) Mannan binding lectin and viral hepatitis. Immunol Lett. 108(1): 34-44.
  • Garred P. (2008) Mannose-binding lectin genetics: from A to Z. Biochem Soc Trans. 36(Pt 6): 1461-6.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Muller YL, et al. (2010) Functional Variants in MBL2 Are Associated With Type 2 Diabetes and Pre-Diabetes Traits in Pima Indians and the Old Order Amish. Diabetes. 59(8): 2080-5.