Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_002000.2)

Product Information

NCBI RefSeq: NM_002000.2

RefSeq ORF Size: 864

cDNA Description: Full length Clone DNA of Homo sapiens Fc fragment of IgA, receptor for (FCAR), transcript variant 1.

Gene Synonym: CD89,CTB-61M7.2,FcalphaRI,FCAR,XXbac-BPG230H20.5

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD89/FCAR transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10414-UTLN pLV-untagged 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10414-CFLN pLV-C-FLAG 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10414-CHLN pLV-C-His 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10414-CMLN pLV-C-Myc 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10414-CYLN pLV-C-HA 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10414-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10414-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10414-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10414-NHLN pLV-SP-N-His 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10414-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD89/FCAR transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10414-NYLN pLV-SP-N-HA 2-3 weeks

Background

FCAR, also called Fc

Reference

    1. Maliszewski, C.R. et al., 1990, J. Exp. Med. 172: 1665-1672.
    2. Launay, P. et al., 1999, J. Biol. Chem. 274: 7216-7225.
    3. Monteiro, R.C. et al., 2003, Annu. Rev. Immunol. 21: 177-204.
    4. Otten, M.A. et al., 2005, J. Immunol. 174: 5472-5480.
    5. Pasquier, B. et al., 2005, Immunity. 22:31-42.
    6. Kanamaru, Y. et al., 2007, Blood. 109: 203-211.