Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid(NM_002422.3)

Product Information

NCBI RefSeq: NM_002422.3

RefSeq ORF Size: 1434

cDNA Description: Full length Clone DNA of Homo sapiens matrix metallopeptidase 3 (stromelysin 1, progelatinase).

Gene Synonym: CHDS6,MMP-3,SL-1,STMY,STMY1,STR1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MMP-3 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid HG10467-UTLN pLV-untagged 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10467-CFLN pLV-C-FLAG 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10467-CHLN pLV-C-His 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10467-CMLN pLV-C-Myc 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10467-CYLN pLV-C-HA 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10467-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10467-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10467-NFLN pLV-SP-N-Flag 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10467-NHLN pLV-SP-N-His 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10467-NMLN pLV-SP-N-Myc 2-3 weeks
Human MMP-3 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10467-NYLN pLV-SP-N-HA 2-3 weeks

Background

Matrix metallopeptidase 3 (abbreviated as MMP3) is also known as stromelysin 1 and progelatinase. MMP3 is a member of the matrix metalloproteinase (MMP) family whose members are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, tissue remodeling, and disease processes including arthritis and metastasis. As a secreted zinc-dependent endopeptidase, MMP3 exerts its functions mainly in extracellular matrix. This protein is activated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMP3 plays a central role in degrading collagen types II, III, IV, IX, and X, proteoglycans, fibronectin, laminin, and elastin. In addition, MMP3 can also active other MMPs such as MMP1, MMP7, and MMP9, rendering MMP3 crucial in connective tissue remodeling. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Synthetic or natural inhibitors of MMPs result in inhibition of metastasis, while up-regulation of MMPs led to enhanced cancer cell invasion.

Reference

  • Sternlicht MD, et al. 1999, The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell. 98(2): 137-46.
  • Yoon S, et al. (1999) Genetic analysis of MMP3, MMP9, and PAI-1 in Finnish patients with abdominal aortic or intracranial aneurysms. Biochem Biophys Res Commun. 265(2): 563-8.
  • Biondi ML, et al. (2000) MMP1 and MMP3 polymorphisms in promoter regions and cancer. Clin Chem. 46(12): 2023-4.