Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid(NM_004590.2)

Product Information

NCBI RefSeq: NM_004590.2

RefSeq ORF Size: 363

cDNA Description: Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 16.

Gene Synonym: CCL16,CKb12,HCC-4,ILINCK,LCC-1,LEC,LMC,Mtn-1,NCC-4,NCC4,SCYA16,SCYL4

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CCL16 / HCC-4 / NCC4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid HG10491-UTLN pLV-untagged 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10491-CFLN pLV-C-FLAG 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10491-CHLN pLV-C-His 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10491-CMLN pLV-C-Myc 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10491-CYLN pLV-C-HA 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10491-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10491-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10491-NFLN pLV-SP-N-Flag 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10491-NHLN pLV-SP-N-His 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10491-NMLN pLV-SP-N-Myc 2-3 weeks
Human CCL16 / HCC-4 / NCC4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10491-NYLN pLV-SP-N-HA 2-3 weeks

Background

Human CCL16, a chemokine poorly characterized at the functional level. Human CCL16 is a member of the CC family, and its gene maps to human chromosome 17q. In the mouse, only a pseudogene has been identified to date. CCL16 is a functional ligand for CCR1, CCR2, CCR5, and CCR8. Recombinant CCL16 demonstrated chemotactic activity on human monocytes and lymphocytes. Based on the ability of human chemokines to exert activity on and bind to murine receptors, the TSA mouse adenocarcinoma cell line was transfected with human CCL16 cDNA and, in comparison with other cytokines, was shown to be the faster inducer of systemic immune response due to massive, prompt infiltration of leukocytes.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Guiducci C, Di Carlo E, Parenza M, et al. Intralesional injection of adenovirus encoding CC chemokine ligand 16 inhibits mammary tumor growth and prevents metastatic-induced death after surgical removal of the treated primary tumor[J]. The Journal of Immunology, 2004, 172(7): 4026-4036.