Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid(NM_005429.2)

Product Information

NCBI RefSeq: NM_005429.2

RefSeq ORF Size: 1260

cDNA Description: Full length Clone DNA of Homo sapiens vascular endothelial growth factor C

Gene Synonym: Flt4-L,LMPH1D,VEGF-C,VRP

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human VEGFC/VEGF-C/Flt4-L Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid HG10542-UTLN pLV-untagged 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10542-CFLN pLV-C-FLAG 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10542-CHLN pLV-C-His 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10542-CMLN pLV-C-Myc 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10542-CYLN pLV-C-HA 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10542-ACGLN pLV-C-GFPSpark 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10542-ACRLN pLV-C-OFPSpark 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10542-NFLN pLV-SP-N-Flag 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10542-NHLN pLV-SP-N-His 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10542-NMLN pLV-SP-N-Myc 2-3 weeks
Human VEGFC/VEGF-C/Flt4-L Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10542-NYLN pLV-SP-N-HA 2-3 weeks

Background

Vascular endothelial growth factor C (VEGF-C) is a member of the VEGF family. Upon biosynthesis, VEGF-C protein is secreted as a non-covalent momodimer in an anti-parellel fashion. VEGF-C protein is a dimeric glycoprotein, as a ligand for two receptors, VEGFR-3 (Flt4), and VEGFR-2. VEGF-C may function in angiogenesis of the venous and lymphatic vascular systems during embryogenesis. VEGF-C protein is over-expressed in various human cancers including breast cancer and prostate cancer. VEGF-C/VEGFR-3 axis, through different signaling pathways, plays a critical role in cancer progression by regulating different cellular functions, such as invasion, proliferation, and resistance to chemotherapy. Thus, targeting the VEGF-C/VEGFR-3 axis may be therapeutically significant for certain types of tumors.

Reference

  • Joukov V, et al. (1997) Vascular endothelial growth factors VEGF-B and VEGF-C. J Cell Physiol. 173(2): 211-5.
  • Su JL, et al. (2007) The role of the VEGF-C/VEGFR-3 axis in cancer progression. Br J Cancer. 96(4): 541-5.
  • Anisimov A, et al. (2009) Activated forms of VEGF-C and VEGF-D provide improved vascular function in skeletal muscle. Circ Res. 104(11): 1302-12.