Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_013993.2)

Product Information

NCBI RefSeq: NM_013993.2

RefSeq ORF Size: 2742

cDNA Description: Full length Clone DNA of Homo sapiens discoidin domain receptor tyrosine kinase 1 , transcript variant 2.

Gene Synonym: CAK,CD167,DDR,EDDR1,HGK2,MCK10,NEP,NTRK4,PTK3,PTK3A,RTK6,TRKE

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human DDR1/MCK10/CD167 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10730-UTLN pLV-untagged 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10730-CFLN pLV-C-FLAG 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10730-CHLN pLV-C-His 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10730-CMLN pLV-C-Myc 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10730-CYLN pLV-C-HA 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10730-ACGLN pLV-C-GFPSpark 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10730-ACRLN pLV-C-OFPSpark 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10730-NFLN pLV-SP-N-Flag 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10730-NHLN pLV-SP-N-His 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10730-NMLN pLV-SP-N-Myc 2-3 weeks
Human DDR1/MCK10/CD167 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10730-NYLN pLV-SP-N-HA 2-3 weeks

Background

Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of differentiation 167a), and Mammary carcinoma kinase 10 (MCK10), belongs to a subfamily of tyrosine kinase receptors with an extracellular domain homologous to Dictyostellium discoideum protein discoidin 1. Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. Expression of DDR1/MCK10/CD167 is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. DDR1/MCK10/CD167 plays an important role in regulating attachment to collagen, chemotaxis, proliferation, and MMP production in smooth muscle cells. DDR1 functions in a feedforward loop to increase p53 levels and at least some of its effectors. Inhibition of DDR1 function resulted in strikingly increased apoptosis of wild-type p53-containing cells in response to genotoxic stress through a caspase-dependent pathway.

Reference

  • Hou G, et al. (2001) The discoidin domain receptor tyrosine kinase DDR1 in arterial wound repair. J Clin Invest. 107(6): 727-35.
  • Ongusaha PP, et al. (2003) p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 22(6): 1289-301.
  • Jönsson M, et al. (2001) Repression of Wnt-5a impairs DDR1 phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci. 114(11): 2043-53.