Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid(NM_001778.2)

Product Information

NCBI RefSeq: NM_001778.2

RefSeq ORF Size: 732

cDNA Description: Full length Clone DNA of Homo sapiens CD48 molecule.

Gene Synonym: BCM1,BLAST,Blast-1,BLAST1,hCD48,mCD48,MEM-102,SLAMF2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD48/Blast-1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid HG10797-UTLN pLV-untagged 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10797-CFLN pLV-C-FLAG 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10797-CHLN pLV-C-His 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10797-CMLN pLV-C-Myc 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10797-CYLN pLV-C-HA 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10797-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10797-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10797-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10797-NHLN pLV-SP-N-His 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10797-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD48/Blast-1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10797-NYLN pLV-SP-N-HA 2-3 weeks

Background

Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging to the CD2 subfamily of immunoglobulin superfamily molecules. CD2 and 2B4 (CD244) are known ligands for CD48. CD48 protein is expressed on most lineage-committed hematopoietic cells but not on hematopoietic stem cells or multipotent hematopoietic progenitors. CD48 protein performs biological functions in a variety processes including adhesion, pathogen recognition, cellular activation, and cytokine regulation, and emerges as a critical effector molecule in immune responses.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Messmer B, et al. (2006) CD48 stimulation by 2B4 (CD244)-expressing targets activates human NK cells. J Immunol. 176(8): 4646-50
  • Milstein O, et al. (2008) Nanoscale increases in CD2-CD48-mediated intermembrane spacing decrease adhesion and reorganize the immunological synapse. J Biol Chem. 283(49): 34414-22.