Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid(NM_002704.2)

Product Information

NCBI RefSeq: NM_002704.2

RefSeq ORF Size: 387

cDNA Description: Full length Clone DNA of Homo sapiens pro-platelet basic protein (chemokine (C-X-C motif) ligand 7).

Gene Synonym: B-TG1,Beta-TG,CTAP-III,CTAP3,CTAPIII,CXCL7,LA-PF4,LDGF,MDGF,NAP-2,PBP,SCYB7,TC1,TC2,TGB,TGB1,THBGB,THBGB1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human NAP-2 / PPBP / CXCL7 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid HG10878-UTLN pLV-untagged 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10878-CFLN pLV-C-FLAG 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10878-CHLN pLV-C-His 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10878-CMLN pLV-C-Myc 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10878-CYLN pLV-C-HA 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10878-ACGLN pLV-C-GFPSpark 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10878-ACRLN pLV-C-OFPSpark 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10878-NFLN pLV-SP-N-Flag 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10878-NHLN pLV-SP-N-His 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10878-NMLN pLV-SP-N-Myc 2-3 weeks
Human NAP-2 / PPBP / CXCL7 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10878-NYLN pLV-SP-N-HA 2-3 weeks

Background

Pro-platelet basic protein (PPBP) is also known as Chemokine (C-X-C motif) ligand 7 (CXCL7) and nucleosome assembly protein (Nap-2). Nap-2 / PPBP / CXCL7 is released in large amounts from platelets following their activation and is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. Nap-2 / PPBP / CXCL7 has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. Nap-2 is a ligand for CXCR1 and CXCR2, and Nap-2, Nap-2 (73), Nap-2 (74), Nap-2 (1-66), and most potent Nap-2 (1-63) are chemoattractants and activators for neutrophils.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Walz A, et al. (1989) Effects of the neutrophil-activating peptide NAP-2, platelet basic protein, connective tissue-activating peptide III and platelet factor 4 on human neutrophils. J Exp Med. 170(5):1745-50.
  • Walz A, et al. (1990) Generation of the neutrophil-activating peptide NAP-2 from platelet basic protein or connective tissue-activating peptide III through monocyte proteases. J Exp Med. 171(2): 449-54.
  • Loetscher P, et al. (1994) Both interleukin-8 receptors independently mediate chemotaxis. Jurkat cells transfected with IL-8R1 or IL-8R2 migrate in response to IL-8, GRO alpha and NAP-2. FEBS Lett. 341(2-3): 187-92.