Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid(NM_003212.2)

Product Information

NCBI RefSeq: NM_003212.2

RefSeq ORF Size: 567

cDNA Description: Full length Clone DNA of Homo sapiens teratocarcinoma-derived growth factor 1.

Gene Synonym: CR,CRGF,CRIPTO

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Cripto/TDGF1/ CRGF Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid HG10908-UTLN pLV-untagged 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10908-CFLN pLV-C-FLAG 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10908-CHLN pLV-C-His 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10908-CMLN pLV-C-Myc 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10908-CYLN pLV-C-HA 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10908-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10908-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10908-NFLN pLV-SP-N-Flag 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10908-NHLN pLV-SP-N-His 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10908-NMLN pLV-SP-N-Myc 2-3 weeks
Human Cripto/TDGF1/ CRGF Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10908-NYLN pLV-SP-N-HA 2-3 weeks

Background

Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family member proteins share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. Before gastrulation, Cripto is asymmetrically expressed in a proximal–distal gradient in the epiblast, and subsequently is expressed in the primitive streak and newly formed embryonic mesoderm. These proteins play key roles in intercellular signaling pathways during vertebrate embryogenesis. Mutations in Cripto/TDGF1 can cause autosomal visceral heterotaxy. Cripto/TDGF1 is involved in left-right asymmetric morphogenesis during organ development. Cripto signalling is essential for the conversion of a proximal–distal asymmetry into an orthogonal anterior–posterior axis. The mechanism of inhibitory effects of the Cripto includes both cancer cell apoptosis, activation of c-Jun-NH(2)-terminal kinase and p38 kinase signaling pathways and blocking of Akt phosphorylation. Thus, Cripto is a unique target, and Immunohistochemistry to Cripto could be of therapeutic value for human cancers.

Reference

  • Calvanese L, et al. (2006) Solution structure of mouse Cripto CFC domain and its inactive variant Trp107Ala. J Med Chem. 49 (24): 7054-62.
  • Lonardo E, et al. (2010) A small synthetic cripto blocking Peptide improves neural induction, dopaminergic differentiation, and functional integration of mouse embryonic stem cells in a rat model of Parkinson's disease. Stem Cells. 28 (8): 1326-37.
  • Chambery A, et al. (2009) Qualitative and quantitative proteomic profiling of cripto(-/-) embryonic stem cells by means of accurate mass LC-MS analysis. J Proteome Res. 8 (2): 1047-58.