Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human C1qB Gene Lentiviral ORF cDNA expression plasmid(NM_000491.3)

Product Information

NCBI RefSeq: NM_000491.3

RefSeq ORF Size: 762

cDNA Description: Full length Clone DNA of Homo sapiens complement component 1, q subcomponent, B chain.

Gene Synonym: C1QB

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human C1qB Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human C1qB Gene Lentiviral ORF cDNA expression plasmid HG10941-UTLN pLV-untagged 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10941-CFLN pLV-C-FLAG 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10941-CHLN pLV-C-His 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10941-CMLN pLV-C-Myc 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10941-CYLN pLV-C-HA 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10941-ACGLN pLV-C-GFPSpark 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10941-ACRLN pLV-C-OFPSpark 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10941-NFLN pLV-SP-N-Flag 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10941-NHLN pLV-SP-N-His 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10941-NMLN pLV-SP-N-Myc 2-3 weeks
Human C1qB Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10941-NYLN pLV-SP-N-HA 2-3 weeks

Background

Complement Component 1, q subcomponent (C1q) associates with C1r and C1s in order to yield the first component of the serum complement system. Deficiency of C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Southern blot analysis of chromosomal DNA from vertebrate species demonstrated highest similarity between the C1qB genes, followed by C1qC and finally C1qA. Sequence comparison of C1q from three different species have shown that the B chains have the strongest similarity. C1q was already present at embryonic day 14 (E14) and showed little change in abundance through six weeks postnatal. At E16, C1qB mRNA was present at high abundance in putative microglia/macrophages in cortical marginal and intermediate zones, and hippocampal analge.

Reference

  • Pasinetti GM, et al. (1992) Complement C1qB and C4 mRNAs responses to lesioning in rat brain. Experimental neurology. 118(2): 117-25.
  • Johnson SA, et al. (1994) Expression of complement C1qB and C4 mRNAs during rat brain development. Brain Res Dev Brain Res. 80(1-2): 163-74.
  • Grewal RP,et al. (1999) C1qB and clusterin mRNA increase in association with neurodegeneration in sporadic amyotrophic lateral sclerosis. Neuroscience letters. 271(1): 65-7.
  • Spielman L, et al. (2002) Induction of the complement component C1qB in brain of transgenic mice with neuronal overexpression of human cyclooxygenase-2. Acta neuropathologica. 103(2): 157-62.