Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid(NM_001792.3)

Product Information

NCBI RefSeq: NM_001792.3

RefSeq ORF Size: 2721

cDNA Description: Full length Clone DNA of Homo sapiens cadherin 2, type 1, N-cadherin (neuronal).

Gene Synonym: CD325,CDHN,CDw325,NCAD

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human N-Cadherin/CD325/CDH2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid HG11039-UTLN pLV-untagged 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11039-CFLN pLV-C-FLAG 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11039-CHLN pLV-C-His 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11039-CMLN pLV-C-Myc 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11039-CYLN pLV-C-HA 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11039-ACGLN pLV-C-GFPSpark 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11039-ACRLN pLV-C-OFPSpark 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11039-NFLN pLV-SP-N-Flag 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11039-NHLN pLV-SP-N-His 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11039-NMLN pLV-SP-N-Myc 2-3 weeks
Human N-Cadherin/CD325/CDH2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11039-NYLN pLV-SP-N-HA 2-3 weeks

Background

Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 (NCAD) has been shown to play an essential role in normal neuronal development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. In addition, N-Cadherin expression was upregulated in human HSC during activation in culture, and function or expression blocking of N-Cadherin promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20-100 kDa fragments. It may provide a novel target for therapies that are directed toward intimal proliferative disorders, including restenosis and vascular bypass graft failure. N-Cadherin is associated with tumor aggressiveness and metastatic potential and may contribute to tumor progression.

Reference

  • Jones M, et al. (2002) N-cadherin upregulation and function in response of smooth muscle cells to arterial injury. Arterioscler Thromb Vasc Biol. 22(12): 1972-7.
  • Nagi C, et al. (2005) N-cadherin expression in breast cancer: correlation with an aggressive histologic variant--invasive micropapillary carcinoma. Breast Cancer Res Treat. 94(3): 225-35.
  • Schrick C, et al. (2007) N-cadherin regulates cytoskeletally associated IQGAP1/ERK signaling and memory formation. Neuron. 55(5): 786-98.
  • Li K, et al. (2010) Downregulation of N-cadherin expression inhibits invasiveness, arrests cell cycle and induces cell apoptosis in esophageal squamous cell carcinoma. Cancer Invest. 28(5): 479-86.