Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid(NM_020996.1)

Product Information

NCBI RefSeq: NM_020996.1

RefSeq ORF Size: 627

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 6.

Gene Synonym: HBGF-6,HST2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF6 / FGF-6 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid HG11528-UTLN pLV-untagged 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11528-CFLN pLV-C-FLAG 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11528-CHLN pLV-C-His 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11528-CMLN pLV-C-Myc 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11528-CYLN pLV-C-HA 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11528-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11528-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11528-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11528-NHLN pLV-SP-N-His 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11528-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGF6 / FGF-6 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11528-NYLN pLV-SP-N-HA 2-3 weeks

Background

FGF6, also known as FGF-6, belongs to the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF6 plays an important role in the regulation of cell proliferation, cell differentiation, angiogenesis and myogenesis. It is also required for normal muscle regeneration. FGF6 gene displayed oncogenic transforming activity when transfected into mammalian cells.

Reference

  • Marics I, et al. (1989) Characterization of the HST-related FGF.6 gene, a new member of the fibroblast growth factor gene family. Oncogene. 4(3):335-40.
  • Coulier F, et al. (1991) Putative structure of the FGF6 gene product and role of the signal peptide. Oncogene. 6(8):1437-44.
  • Iida S, et al. (1992) Human hst-2 (FGF-6) oncogene: cDNA cloning and characterization. Oncogene. 7(2):303-9.