Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid(NM_172212.2)

Product Information

NCBI RefSeq: NM_172212.2

RefSeq ORF Size: 1665

cDNA Description: Full length Clone DNA of Homo sapiens colony stimulating factor 1 (macrophage) transcript variant 4.

Gene Synonym: CSF-1,M-CSF,MCSF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human M-CSF/CSF-1 transcript variant 4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid HG11792-UTLN pLV-untagged 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11792-CFLN pLV-C-FLAG 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11792-CHLN pLV-C-His 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11792-CMLN pLV-C-Myc 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11792-CYLN pLV-C-HA 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11792-ACGLN pLV-C-GFPSpark 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11792-ACRLN pLV-C-OFPSpark 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11792-NFLN pLV-SP-N-Flag 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11792-NHLN pLV-SP-N-His 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11792-NMLN pLV-SP-N-Myc 2-3 weeks
Human M-CSF/CSF-1 transcript variant 4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11792-NYLN pLV-SP-N-HA 2-3 weeks

Background

Macrophage colony-stimulating factor 1, also known as CSF-1, M-CSF, Lanimostim and CSF1, is a single-pass membrane protein which is disulfide-linked as a homodimer or heterodimer. Granulocyte / macrophage colony-stimulating factors are cytokines that act in hematopoiesis by controlling the production, differentiation, and function of 2 related white cell populations of the blood, the granulocytes and the monocytes-macrophages. M-CSF/CSF-1 is known to facilitate monocyte survival, monocyte-to-macrophage conversion, and macrophage proliferation. M-CSF/CSF-1 is a secreted cytokine which influences hemopoietic stem cells to differentiate into macrophages or other related cell types. It binds to the Colony stimulating factor 1 receptor. M-CSF/CSF-1 may also be involved in development of the placenta. The active form of M-CSF/CSF-1 is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. M-CSF/CSF-1 induces cells of the monocyte/macrophage lineage. It also plays a role in immunological defenses, bone metabolism, lipoproteins clearance, fertility and pregnancy. Upregulation of M-CSF/CSF-1 in the infarcted myocardium may have an active role in healing not only through its effects on cells of monocyte/macrophage lineage, but also by regulating endothelial cell chemokine expression.

Reference

    1. Pandit J. et al., 1992, Science. 258: 1358-62.
    2. Tokai M. et al., 2000, J Bacteriol. 182 (10): 2865-8.
    3. Fan X. et al., 2001, Am J Physiol Endocrinol Metab. 280 (1): E103-11.
    4. Frangogiannis NG. et al., 2003, Am J Physiol Heart Circ Physiol. 285 (2): H483-92.
    5. Cupp JS. et al., 2007, Am J Surg Pathol. 31 (6): 970-6.