Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid(BC047698)

Product Information

NCBI RefSeq: BC047698

RefSeq ORF Size: 534

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 7.

Gene Synonym: IL-7,Interleukin-7

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL7/IL-7/Interleukin-7 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid HG11821-UTLN pLV-untagged 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11821-CFLN pLV-C-FLAG 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11821-CHLN pLV-C-His 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11821-CMLN pLV-C-Myc 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11821-CYLN pLV-C-HA 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11821-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11821-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11821-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11821-NHLN pLV-SP-N-His 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11821-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL7/IL-7/Interleukin-7 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11821-NYLN pLV-SP-N-HA 2-3 weeks

Background

IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.