Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid(BC010525)

Product Information

NCBI RefSeq: BC010525

RefSeq ORF Size: 1200

cDNA Description: Full length Clone DNA of Homo sapiens V-set and immunoglobulin domain containing 4.

Gene Synonym: CRIg,Z39IG

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human VSIG4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid HG12163-UTLN pLV-untagged 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12163-CFLN pLV-C-FLAG 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12163-CHLN pLV-C-His 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12163-CMLN pLV-C-Myc 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12163-CYLN pLV-C-HA 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12163-ACGLN pLV-C-GFPSpark 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12163-ACRLN pLV-C-OFPSpark 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12163-NFLN pLV-SP-N-Flag 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12163-NHLN pLV-SP-N-His 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12163-NMLN pLV-SP-N-Myc 2-3 weeks
Human VSIG4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12163-NYLN pLV-SP-N-HA 2-3 weeks

Background

VSIG4 (V-set and immunoglobulin domain containing 4), also known as complement receptor of the immunoglobulin superfamily (CRIg) and Z39Ig, is a type I  transmembrane glycoprotein. It is a B7 family-related protein and an Ig superfamily member. In contrast to the B7 family members which contain two IgG domains, VSIG4 contains one complete V-type I g domain and a truncated C-type I g domain. VSIG4 is exclusively expressed on tissue resident macrophages and binds to multimers of C3b and iC3b that are covalently attached to particle surfaces. No VSIG4 expression appears to be present in T and B cells. VSIG4 functions as a negative regulator of T cell activation, and may be involved in the maintenance of peripheral T cell tolerance, and is also identified as a potent suppressor of established inflammation. Mouse VSIG4 is synthesized as a 280 amino acid precursor that contains a signal sequence, an V-type I g domain (aa 36-115), one potential N-linked glycosylation site, and a single transmembrane domain. The V-type I g domain of mouse VSIG4 shares 86% and 80% aa sequence identity with the V-type I g domains of rat and human VSIG4, respectively.

Reference

  • Vogt, L. et al., 2006, J Clin Invest.116: 2817-2826.
  • Helmy, K. et al., 2006, Cell. 124:915-927.
  • Wiesmann, C. et al., 2006, Nature. 444:217-220.
  • Zang,X. et al., 2006, J Clin Invest. 116: 2590-2593.
  • Katschke, KJ. et al., 2007, J. Exp. Med. 204:1319-1325.
  • He,JQ. et al., 2008, Mol Immunol. 45: 4041-4047.