Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid(BC015801)

Product Information

NCBI RefSeq: BC015801

RefSeq ORF Size: 2031

cDNA Description: Full length Clone DNA of Homo sapiens protein S (alpha).

Gene Synonym: PROS,Protein S,PS21,PS22,PS23,PS24,PS25,PSA,THPH5,THPH6

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PROS1/Protein S Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid HG12179-UTLN pLV-untagged 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12179-CFLN pLV-C-FLAG 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12179-CHLN pLV-C-His 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12179-CMLN pLV-C-Myc 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12179-CYLN pLV-C-HA 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12179-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12179-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12179-NFLN pLV-SP-N-Flag 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12179-NHLN pLV-SP-N-His 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12179-NMLN pLV-SP-N-Myc 2-3 weeks
Human PROS1/Protein S Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12179-NYLN pLV-SP-N-HA 2-3 weeks

Background

PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.

Reference

  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • Garc