Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid(BC014465)

Product Information

NCBI RefSeq: BC014465

RefSeq ORF Size: 546

cDNA Description: Full length Clone DNA of Homo sapiens CD160 molecule.

Gene Synonym: BY55,NK1,NK28

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD160/NK1/BY55 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid HG12191-UTLN pLV-untagged 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12191-CFLN pLV-C-FLAG 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12191-CHLN pLV-C-His 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12191-CMLN pLV-C-Myc 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12191-CYLN pLV-C-HA 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12191-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12191-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12191-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12191-NHLN pLV-SP-N-His 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12191-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD160/NK1/BY55 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12191-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD160 antigen, also known as Natural killer cell receptor BY55 and CD160, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD160 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD160 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD160 is expressed in spleen, peripheral blood, and small intestine. Expression of CD160 is restricted to functional NK and T cytotoxic lymphocytes. CD160 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD160+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD160+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD160 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.