Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid(BC017664)

Product Information

NCBI RefSeq: BC017664

RefSeq ORF Size: 651

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 19.

Gene Synonym: FGF19

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF19 / FGF-19 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid HG12226-UTLN pLV-untagged 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12226-CFLN pLV-C-FLAG 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12226-CHLN pLV-C-His 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12226-CMLN pLV-C-Myc 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12226-CYLN pLV-C-HA 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12226-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12226-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12226-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12226-NHLN pLV-SP-N-His 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12226-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGF19 / FGF-19 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12226-NYLN pLV-SP-N-HA 2-3 weeks

Background

FGF19, also known as FGF-19, is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF19 interacts with FGFR1, FGFR2, FGFR3 and FGFR4. Affinity between fibroblast growth factors (FGFs) and their receptors is increased by KL, KLB and heparan sulfate glycosaminoglycans that function as coreceptors. It interacts with KL and KLB directly. However, it interacts with FGFR4 in the presence of heparin, KL or KLB. FGF19 is involved in the suppression of bile acid biosynthesis through down-regulation of CYP7A1 expression, following positive regulation of the JNK and ERK1/2 cascades. It also stimulates glucose uptake in adipocytes.

Reference

  • Tamimi Y, et al. (2006) FGF19 is a target for FOXC1 regulation in ciliary body-derived cells. Hum Mol Genet. 15(21):3229-40.
  • Goetz R, et al. (2007) Molecular insights into the klotho-dependent, endocrine mode of action of fibroblast growth factor 19 subfamily members. Mol Cell Biol. 27(9):3417-28.
  • Harmer NJ, et al. (2004) The crystal structure of fibroblast growth factor (FGF) 19 reveals novel features of the FGF family and offers a structural basis for its unusual receptor affinity. Biochemistry. 43(3):629-40.