Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid(BC112300)

Product Information

NCBI RefSeq: BC112300

RefSeq ORF Size: 570

cDNA Description: Full length Clone DNA of Homo sapiens interferon, alpha 1.

Gene Synonym: IFL,IFN,IFN-ALPHA,IFN-alphaD,IFNA13,IFNA@

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IFN-alpha / IFNA1 / IFN Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid HG12341-UTLN pLV-untagged 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12341-CFLN pLV-C-FLAG 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12341-CHLN pLV-C-His 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12341-CMLN pLV-C-Myc 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12341-CYLN pLV-C-HA 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12341-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12341-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12341-NFLN pLV-SP-N-Flag 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12341-NHLN pLV-SP-N-His 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12341-NMLN pLV-SP-N-Myc 2-3 weeks
Human IFN-alpha / IFNA1 / IFN Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12341-NYLN pLV-SP-N-HA 2-3 weeks

Background

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.