Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human C6 Gene Lentiviral ORF cDNA expression plasmid(BC035723)

Product Information

NCBI RefSeq: BC035723

RefSeq ORF Size: 2805

cDNA Description: Full length Clone DNA of Homo sapiens complement component 6.

Gene Synonym: C6

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human C6 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human C6 Gene Lentiviral ORF cDNA expression plasmid HG12426-UTLN pLV-untagged 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12426-CFLN pLV-C-FLAG 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12426-CHLN pLV-C-His 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12426-CMLN pLV-C-Myc 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12426-CYLN pLV-C-HA 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12426-ACGLN pLV-C-GFPSpark 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12426-ACRLN pLV-C-OFPSpark 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12426-NFLN pLV-SP-N-Flag 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12426-NHLN pLV-SP-N-His 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12426-NMLN pLV-SP-N-Myc 2-3 weeks
Human C6 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12426-NYLN pLV-SP-N-HA 2-3 weeks