Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF18 Gene Lentiviral ORF cDNA expression plasmid(BC006245)

Product Information

NCBI RefSeq: BC006245

RefSeq ORF Size: 624

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 18.

Gene Synonym: FGF-18,ZFGF5

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF18 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid HG13206-UTLN pLV-untagged 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13206-CFLN pLV-C-FLAG 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13206-CHLN pLV-C-His 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13206-CMLN pLV-C-Myc 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13206-CYLN pLV-C-HA 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13206-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13206-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13206-NFLN pLV-SP-N-Flag 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13206-NHLN pLV-SP-N-His 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13206-NMLN pLV-SP-N-Myc 2-3 weeks
Human FGF18 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13206-NYLN pLV-SP-N-HA 2-3 weeks

Background

Fibroblast growth factor 18 (FGF18) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that FGF18 is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Experiment datas identified FGF18 as a selective ligand for FGFR3 in limb bud mesenchymal cells, which suppressed proliferation and promoted their differentiation and production of cartilage matrix. FGF18 appears to regulate cell proliferation and differentiation positively in osteogenesis and negatively in chondrogenesis.

Reference

  • Ohbayashi N, et al. (2002) FGF18 is required for normal cell proliferation and differentiation during osteogenesis and chondrogenesis. Genes Dev. 16(7): 870-9.
  • Davidson D, et al. (2005) Fibroblast growth factor (FGF) 18 signals through FGF receptor 3 to promote chondrogenesis. J Biol Chem. 280(21): 20509-15.
  • Liu Z, et al. (2007) FGF18 is required for early chondrocyte proliferation, hypertrophy and vascular invasion of the growth plate. Dev Biol. 302(1): 80-91.