Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid(BC109306)

Product Information

NCBI RefSeq: BC109306

RefSeq ORF Size: 2028

cDNA Description: Full length Clone DNA of Homo sapiens CD22 molecule.

Gene Synonym: SIGLEC-2,SIGLEC2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD22/Siglec-2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid HG11958-UTLN pLV-untagged 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11958-CFLN pLV-C-FLAG 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11958-CHLN pLV-C-His 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11958-CMLN pLV-C-Myc 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11958-CYLN pLV-C-HA 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11958-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11958-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11958-NFLN pLV-N-Flag 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11958-NHLN pLV-N-His 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11958-NMLN pLV-N-Myc 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11958-NYLN pLV-N-HA 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11958-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CD22/Siglec-2 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11958-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first expressed in the cytoplasm of pro-B and pre-B cells, and on the surface as B cells mature to become IgD+. CD22 serves as an adhesion receptor for sialic acid-bearing ligands expressed on erythrocytes and all leukocyte classes. In addition to its potential role as a mediator of intercellular interactions, signal transduction through CD22 can activate B cells and modulate antigen receptor signaling in vitro. The phenotype of CD22-deficient mice suggests that CD22 is primarily involved in the generation of mature B cells within the bone marrow, blood, and marginal zones of lymphoid tissues. CD22 recruits the tyrosine phosphatase Src homology 2 domain-containing phosphatase 1 (SHP-1) to immunoreceptor tyrosine-based inhibitory motifs (ITIMs) and inhibits B-cell receptor (BCR)-induced Ca2+ signaling on normal B cells. CD22 interacts specifically with ligands carrying alpha2-6-linked sialic acids. As an inhibitory coreceptor of the B-cell receptor (BCR), CD22 plays a critical role in establishing signalling thresholds for B-cell activation. Like other coreceptors, the ability of CD22 to modulate B-cell signalling is critically dependent upon its proximity to the BCR, and this in turn is governed by the binding of its extracellular domain to alpha2,6-linked sialic acid ligands. However, genetic studies in mice reveal that some CD22 functions are regulated by ligand binding, whereas other functions are ligand-independent and may only require expression of an intact CD22 cytoplasmic domain at the B-cell surface. CD19 regulates CD22 phosphorylation by augmenting Lyn kinase activity, while CD22 inhibits CD19 phosphorylation via SHP-1.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Tedder TF, et al. (1997) CD22, a B lymphocyte-specific adhesion molecule that regulates antigen receptor signaling. Annu Rev Immunol. 15: 481-504.
  • Tedder TF, et al. (2005) CD22: a multifunctional receptor that regulates B lymphocyte survival and signal transduction. Adv Immunol. 88: 1-50.
  • Fujimoto M, et al. (2007) B cell signaling and autoimmune diseases: CD19/CD22 loop as a B cell signaling device to regulate the balance of autoimmunity. J Dermatol Sci. 46(1): 1-9.
  • Walker JA, et al. (2008) CD22: an inhibitory enigma. Immunology. 123(3): 314-25.
  • Nitschke L. (2009) CD22 and Siglec-G: B-cell inhibitory receptors with distinct functions. Immunol Rev. 230(1): 128-43.