Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CPN1 Gene Lentiviral ORF cDNA expression plasmid(BC027897)

Product Information

NCBI RefSeq: BC027897

RefSeq ORF Size: 1377

cDNA Description: Full length Clone DNA of Homo sapiens carboxypeptidase N, polypeptide 1.

Gene Synonym: CPN,SCPN

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CPN1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid HG13272-UTLN pLV-untagged 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13272-CFLN pLV-C-FLAG 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13272-CHLN pLV-C-His 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13272-CMLN pLV-C-Myc 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13272-CYLN pLV-C-HA 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13272-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13272-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13272-NFLN pLV-SP-N-Flag 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13272-NHLN pLV-SP-N-His 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13272-NMLN pLV-SP-N-Myc 2-3 weeks
Human CPN1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13272-NYLN pLV-SP-N-HA 2-3 weeks