Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD46 Gene Lentiviral ORF cDNA expression plasmid(BC030594)

Product Information

NCBI RefSeq: BC030594

RefSeq ORF Size: 1155

cDNA Description: Full length Clone DNA of Homo sapiens CD46 molecule, complement regulatory protein.

Gene Synonym: AHUS2,MCP,MIC10,TLX,TRA2.10

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD46 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD46 Gene Lentiviral ORF cDNA expression plasmid HG12239-UTLN pLV-untagged 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12239-CFLN pLV-C-FLAG 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12239-CHLN pLV-C-His 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12239-CMLN pLV-C-Myc 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12239-CYLN pLV-C-HA 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12239-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12239-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12239-NFLN pLV-N-Flag 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12239-NHLN pLV-N-His 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12239-NMLN pLV-N-Myc 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12239-NYLN pLV-N-HA 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG12239-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CD46 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG12239-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

CD46, also known as Membrane Cofactor Protein (MCP), is a complement regulatory protein. CD46 is a type 1 membrane protein that plays an important inhibitory role in the complement system. CD46 is expressed in white blood cells, platelets, epithelial cells, and fibroblasts. Human CD46 shares 50% amino acid sequence identity with mouse and rat CD46. The importance of CD46 to complement regulation is underscored by the observation that genetic loss of CD46 leads to development of atypical hemolytic-uremic syndrome (aHUS), a disease characterized by uncontrolled complement activation. CD46 is implicated in the development and/or progression of selected cancer types.

Reference

  • Lublin D.M., et al.,(1988), Molecular cloning and chromosomal localization of human membrane cofactor protein (MCP). Evidence for inclusion in the multigene family of complement-regulatory proteins. J. Exp. Med. 168:181-194.
  • Purcell D.F., et al., (1991), Alternatively spliced RNAs encode several isoforms of CD46 (MCP), a regulator of complement activation.Immunogenetics 33:335-344.
  • Post T.W., et al.,(1991), Membrane cofactor protein of the complement system: alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails produces multiple isoforms that correlate with protein phenotype.J. Exp. Med. 174:93-102.