Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_001786.4)

Product Information

NCBI RefSeq: NM_001786.4

RefSeq ORF Size: 894

cDNA Description: Full length Clone DNA of Homo sapiens cell division cycle 2, G1 to S and G2 to M transcript variant 1.

Gene Synonym: CDC2,CDC28A,P34CDC2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CDC2 Kinase / CDK1 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10739-UTLN pLV-untagged 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10739-CFLN pLV-C-FLAG 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10739-CHLN pLV-C-His 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10739-CMLN pLV-C-Myc 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10739-CYLN pLV-C-HA 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10739-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10739-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10739-NFLN pLV-N-Flag 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10739-NHLN pLV-N-His 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10739-NMLN pLV-N-Myc 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10739-NYLN pLV-N-HA 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10739-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CDC2 Kinase / CDK1 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10739-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

Reference

  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.