Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CDC37 Gene Lentiviral ORF cDNA expression plasmid(NM_007065.3)

Product Information

NCBI RefSeq: NM_007065.3

RefSeq ORF Size: 1137

cDNA Description: Full length Clone DNA of Homo sapiens cell division cycle 37 homolog (S. cerevisiae).

Gene Synonym: P50CDC37

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CDC37 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid HG10647-UTLN pLV-untagged 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10647-CFLN pLV-C-FLAG 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10647-CHLN pLV-C-His 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10647-CMLN pLV-C-Myc 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10647-CYLN pLV-C-HA 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10647-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10647-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10647-NFLN pLV-N-Flag 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10647-NHLN pLV-N-His 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10647-NMLN pLV-N-Myc 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10647-NYLN pLV-N-HA 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10647-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CDC37 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10647-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent with a positive role in proliferation and is required for cell division in budding yeast. CDC37 is though to play an important role in the establishment of signaling pathways controlling cell proliferation through targeting intrinsically unstable oncoprotein kinases such as Cdk-4, Raf-1, and src to the molecular chaperone Hsp90. Decreased Hsp90 expression can reduce the levels of microtubule-associated protein tau, whose overexpression may induce many diseases. CDC37 is considered as a co-chaperone that is classified to Hsp90's accessory proteins. It has been reported that suppression of Cdc37 destabilized tau, leading to its clearance, whereas cdc37 overexpression preserved tau.Cdc37 was found to co-localize with tau in neuronal cells and to physically interact with tau from human brain. Moreover, Cdc37 levels significantly increased with age.

Reference

  • Dai K, et al. (1996) P hysical Interaction of Mammalian CDC37 with CDK4. The journal of biological chemistry. 271: 22030-4.
  • Pearl LH, et al. (2005) Hsp90 and Cdc37-a chaperone cancer conspiracy. Current opinion in genetics development. 15 (1): 55-61.
  • Chen GQ, et al. (2002) TNF-Induced Recruitment and Activation of the IKK Complex Require Cdc37 and Hsp90. Molecular cell. 9 (2): 401-10.