Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid(BC063851)

Product Information

NCBI RefSeq: BC063851

RefSeq ORF Size: 2532

cDNA Description: Full length Clone DNA of Homo sapiens complement component 7.

Gene Synonym: C7

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Complement component 7 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid HG13848-UTLN pLV-untagged 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13848-CFLN pLV-C-FLAG 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13848-CHLN pLV-C-His 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13848-CMLN pLV-C-Myc 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13848-CYLN pLV-C-HA 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13848-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13848-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13848-NFLN pLV-SP-N-Flag 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13848-NHLN pLV-SP-N-His 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13848-NMLN pLV-SP-N-Myc 2-3 weeks
Human Complement component 7 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13848-NYLN pLV-SP-N-HA 2-3 weeks

Background

Complement component 7 is a component of the complement system. It belongs to the complement C6/C7/C8/C9 family. It contains 1 EGF-like domain, 1 LDL-receptor class A domain, 1 MACPF domain, 2 Sushi (CCP/SCR) domains and 2 TSP type-1 domains. Complement component 7 serves as a membrane anchor. It participates in the formation of Membrane Attack Complex (MAC). People with C7 deficiency are prone to bacterial infection. It is a constituent of MAC that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. Defects in C7 are a cause of complement component 7 deficiency (C7D). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis.

Reference

  • Bossi F, et al. (2009) C7 is expressed on endothelial cells as a trap for the assembling terminal complement complex and may exert anti-inflammatory function. Blood. 113(15):3640-8.
  • Kuijpers TW, et al. (2010) Complement factor 7 gene mutations in relation to meningococcal infection and clinical recurrence of meningococcal disease. Mol Immunol. 47(4):671-7.
  • Thomas AD, et al. (2012) Characterization of a large genomic deletion in four Irish families with C7 deficiency. Mol Immunol. 50(1-2):57-9.