Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human C8A Gene Lentiviral ORF cDNA expression plasmid(BC132913)

Product Information

NCBI RefSeq: BC132913

RefSeq ORF Size: 1755

cDNA Description: Full length Clone DNA of Homo sapiens complement component 8, alpha polypeptide.

Gene Synonym: C8A

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human C8A Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human C8A Gene Lentiviral ORF cDNA expression plasmid HG13985-UTLN pLV-untagged 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13985-CFLN pLV-C-FLAG 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13985-CHLN pLV-C-His 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13985-CMLN pLV-C-Myc 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13985-CYLN pLV-C-HA 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13985-ACGLN pLV-C-GFPSpark 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13985-ACRLN pLV-C-OFPSpark 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13985-NFLN pLV-SP-N-Flag 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13985-NHLN pLV-SP-N-His 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13985-NMLN pLV-SP-N-Myc 2-3 weeks
Human C8A Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13985-NYLN pLV-SP-N-HA 2-3 weeks