Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_001798.3)

Product Information

NCBI RefSeq: NM_001798.3

RefSeq ORF Size: 897

cDNA Description: Full length Clone DNA of Homo sapiens cyclin-dependent kinase 2 ,transcript variant 1.

Gene Synonym: CDKN2,p33(CDK2)

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CDK2 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10624-UTLN pLV-untagged 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10624-CFLN pLV-C-FLAG 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10624-CHLN pLV-C-His 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10624-CMLN pLV-C-Myc 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10624-CYLN pLV-C-HA 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10624-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10624-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10624-NFLN pLV-N-Flag 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10624-NHLN pLV-N-His 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10624-NMLN pLV-N-Myc 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10624-NYLN pLV-N-HA 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10624-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CDK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10624-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

CDK2 is a member of the Ser/Thr protein kinase family. This protein kinase is highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2. It is a catalytic subunit of the cyclin-dependent protein kinase complex, whose activity is restricted to the G1-S phase, and essential for cell cycle G1/S phase transition. Cdks (cyclin-dependent kinases) are heteromeric serine/threonine kinases that control progression through the cell cycle in concert with their regulatory subunits, the cyclins. Cdks are constitutively expressed and are regulated by several kinases and phosphastases, including Wee1, CDK-activating kinase and Cdc25 phosphatase. Although there are 12 different cdk genes, only 5 have been shown to directly drive the cell cycle (Cdk1, -2, -3, -4, and -6). Following extracellular mitogenic stimuli, cyclin D gene expression is upregulated. Cdk4 forms a complex with cyclin D and phosphorylates Rb protein, leading to liberation of the transcription factor E2F. E2F induces transcription of genes including cyclins A and E, DNA polymerase and thymidine kinase. Cdk4-cyclin E complexes form and initiate G1/S transition. Subsequently, Cdk1-cyclin B complexes form and induce G2/M phase transition. Cdk1-cyclin B activation induces the breakdown of the nuclear envelope and the initiation of mitosis. CDK2 associates with and regulated by the regulatory subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A) and p27Kip1 (CDKN1B). Its activity is also regulated by its protein phosphorylation. CDK2 is involved in the control of the cell cycle. It also interacts with cyclins A, B1, B3, D, or E. Activity of CDK2 is maximal during S phase and G2.

Reference

  • Bao ZQ, et al. (2011) Briefly bound to activate: transient binding of a second catalytic magnesium activates the structure and dynamics of CDK2 kinase for catalysis. Structure. 19(5):675-90.
  • Neganova I, et al. (2011) An important role for CDK2 in G1 to S checkpoint activation and DNA damage response in human embryonic stem cells. Stem Cells. 29(4):651-9.
  • Li J, et al. (2011) Phosphorylation of MCM3 protein by cyclin E/cyclin-dependent kinase 2 (Cdk2) regulates its function in cell cycle. J Biol Chem. 286(46):39776-85.
  • Buis J, et al. (2012) Mre11 regulates CtIP-dependent double-strand break repair by interaction with CDK2. Nat Struct Mol Biol. 19(2):246-52.