Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CDK3 Gene Lentiviral ORF cDNA expression plasmid(NM_001258.2)

Product Information

NCBI RefSeq: NM_001258.2

RefSeq ORF Size: 918

cDNA Description: Full length Clone DNA of Homo sapiens cyclin-dependent kinase 3.

Gene Synonym: CDK3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CDK3 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid HG10891-UTLN pLV-untagged 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10891-CFLN pLV-C-FLAG 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10891-CHLN pLV-C-His 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10891-CMLN pLV-C-Myc 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10891-CYLN pLV-C-HA 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10891-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10891-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10891-NFLN pLV-N-Flag 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10891-NHLN pLV-N-His 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10891-NMLN pLV-N-Myc 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10891-NYLN pLV-N-HA 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10891-ANGLN pLV-N-GFPSpark 2-3 weeks
Human CDK3 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10891-ANRLN pLV-N-OFPSpark 2-3 weeks